IUPAC

3

9. GCCCTTCCCCATGCCGACGAAACC

With remarkable foresight, it was back in 1972 that the International Union of Pure and Applied Chemistry (IUPAC) assigned official single letter abbreviations for amino acids. The idea was actually proposed by IUPAC four years earlier…and may have been suggested by others as far back as 1958! The 1972 proposal noted:

Various difficulties are encountered when presenting the formulas of long protein sequences in the usual three letter symbols. Space is often at a premium. A one-letter code minimizes this difficulty and has other distinct advantages.

In addition to providing letters for the 20 proteinogenic amino acids, IUPAC also assigned additional letters to represent two closely related pairs of amino acids: asparagine (N) or aspartic acid (D) could be represented by B, and glutamine (Q) or glutamic acid (E) could be represented by Z. Additionally, a 23rd letter (X) was used to represent unknown amino acids.

This arrangement served the world pretty well until research showed that two of the three signatures that normally mark the point where DNA should no longer be translated into protein — the so called stop codons — are sometimes used to code for rare amino acids instead. Thus we had the discoveries of Selenocysteine in 1986 and Pyrrolysine as recently as 2002. IUPAC reacted by assigning these amino acids the letters U and O respectively.

This only leaves the letter J unaccounted for. Although IUPAC has not officially sanctioned its use, they have noted that J is sometimes used in NMR work to represent the amino acids isoleucine (I) or leucine (L). This means that if a 23rd amino acid is discovered, there are no remaining letters in the (Roman) alphabet that can be assigned to it. Though there are still many other characters on your keyboard

iupac.org
IUPAC is naming the four new elements nihonium, moscovium, tennessine, and oganesson - IUPAC | International Union of Pure and Applied Chemistry
Provisional recommendations - for public review: IUPAC is naming the four new elements nihonium, moscovium, tennessine, and oganesson

Did you know that the Othmer Library has a collection of IUPAC records (1919-1965) in its archives? We also have a collection of print photographs documenting the officers and activities of IUPAC from 1925 to 1995 (bulk 1980s). 

Wild Ununquadium and Ununhexium appeared.

Researchers used IUPAC, it’s super effective; Wild elements were confirmed!

Such exciting news in the world of science with the confirmation of two new elements (114 and 116) in a no doubt intense review process between IUPAC and IUPAP.

External image

However you wont be saying hello to these new elements anytime soon as they only exist for fleeting moments and are only born of collisions between other atoms (such as calcium, plutonium and curium), smashing around in labs and hidden behind thick doors.

It is important to note that these elements were not just found in some happy turn of fate. Years ago when the periodic table was being formed and tweaked these elements were proposed to be able to exist, and as such many curious scientist have attempted to make it so.
While Ununquadium and Ununhexium aren’t exactly the most eloquent and majestic of names, never fear because they won’t last long. The labs that created the elements get the prestigious honour of naming them.

On a lighter note though many science enthusiasts the world over would be rather upset, as this means a trip to the shops to purchase a more up to date periodic table.

For the news articles or the IUPAC journal article follow these links:
http://www.boston.com/news/science/articles/2011/06/09/2_new_elements_officially_added_to_periodic_table/
http://www.bbc.co.uk/news/science-environment-13699575
http://www.guardian.co.uk/science/punctuated-equilibrium/2011/jun/09/2
http://iupac.org/publications/pac/pdf/asap/pdf/PAC-REP-10-05-01.pdf

hi, my name is S)-N-((R)-1-(((3S,6R,7S,10R,11S,15S,17S,20S,25aS)-10-((S)-sec-butyl)-11-hydroxy-20-isobutyl-15-isopropyl-3-(4-methoxybenzyl)-2,6,17-trimethyl-1,4,8,13,16,18,21-heptaoxodocosahydro-1H-pyrrolo[2,1-f][1,15,4,7,10,20]dioxatetraazacyclotricosin-7-yl)amino)-4-methyl-1-oxopentan-2-yl)-N-methyl-1-(2-oxopropanoyl)pyrrolidine-2-carboxamide,

but you can call me Aplidine.

chemistry2011.org
International Year of Chemistry 2011

The International Year of Chemistry 2011 (IYC 2011) is a worldwide celebration of the achievements of chemistry and its contributions to the well-being of humankind. Under the unifying theme “Chemistry—our life, our future,” IYC 2011 will offer a range of interactive, entertaining, and educational activities for all ages. The Year of Chemistry is intended to reach across the globe, with opportunities for public participation at the local, regional, and national level.

        –IYC 2011 

I’m at Dubai International Airport right now, 12.20 am Local time (4.20am Malaysia Time)!! It’s just the first transit and I’m halfway dead already!! 2 more to go!! I hope I can still stand up straight once I arrive at Puerto Rico Airport (> 24 hours later) :)

The above update is as promised! Stay tuned for more!! ♥ Thanks for all your support!