THIS CLASSIC CHARACTER PISSED ME OFF SO MUCH DURING A HUNT SO I TRIED TO DRAG IT DOWN WITH MY CLUTCH CLAW BUT IT HOOKED ON TO HIM AND I REFUSED TO LET GO
Lions roar to communicate. Male lions also roar around his home to protect it. Their roars are really loud and Sora starts practicing at a very young age.
Bach: Jesus bleibet meine freude, BWV 147
how insanely satisfying
When you can’t afford 10 pounds a month for Spotify.
tfw you can't afford a music service so you just create a huge ass spine out of tree corpses to rattle the forest to it's core with a delightful melody.


*Clocks By Coldplay*
I had forgotten all about the Cardcaptor Spanish dub memes
Some of y’all don’t know what I’m talking about but in the one dub, one character (Naoko) has a really shrill voice and she always delivers her lines like she’s yelling
[turn down your audio trust me, they bump up her volume for comedic effect and it’s a lot]
*That first one, she’s whispering (scream-whispering?) so that’s why she sounds like Beaker from the Muppets
The funny part is that the last line she says is Y yo tengo que ir al otorrino
The word otorrino(laringólogo/a) in Spanish is “the ENT doctor” or “ears nose and throat doctor”. All this time this girl really did need to go to the ENT but never did so she’s just out here screaming her lines.
You ever hear a kid screaming somewhere in the distance and think “What if??“
“have you not figured out that youve already been captured” “uuuuuUUUUUUUWAAAHHHH”
man: “have you not figured out that youve already been captured?”
frog:
frog:
“It did not growl. It did not make any sounds. It just tried to get in. Apparently it was scared and tried to shelter itself,” said Ray Zavalas, Quiznos employee.
Imagine being at Quiznos and seeing a whole-ass coyote blocking the drinks
me: can you pass me the gatorade?
coyote: which color?
Me: ... ... My brain's so high it can relate to me again.
Cashier in the back: *concerned groan*
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
HEROES VANQUISHED
tfw ur trying to move out but dad keeps asking his employees to stand in front of the door and they tell you to go feed your dog instead
this is what happened right?
Say Their Names
Day 1 of Tumblr’s #ActsOfPride campaign:
These are the black trans lives we have lost due to violence in the United States since 2009. Sadly, this is most likely not a complete list as many of the souls we have lost go unreported or were misgendered. They will not be forgotten.
Caprice Curry, 31 - Killed January 17, 2009 Jimmy McCollough, 34 - Killed April 14, 2009 Foxy Ivy, mid 30s - May 23, 2009 Christopher Jermaine Scott, 36 - Killed July 1, 2009 Beyonce (Eric) Lee, 21 - Killed July 26, 2009 Tyli’a Mack, 21 - Killed August 26, 2009 Dee Green, 25 - Killed October 26, 2009 Toni Alston, 44 - Killed April 3, 2010 Chanel (Dana A. Larkin), 26 - Killed May 7, 2010 Sandy Woulard, 28 - Killed June 21, 2010 Victoria Carmen White, 28 - Killed September 8, 2010 Stacey Lee aka Stacey Blahnik, 31 - Killed October 11, 2010 Tyra Trent, 25 - Killed February 19, 2011 Marcal Camero Tye, 25 - Killed March 8, 2011 Miss Nate Nate, 44 - Killed June 13, 2011 Lashai Mclean, 23 - Killed July 20, 2011 Shelley Hilliard, 19 - Killed October 23, 2011 Chassity Nathan Vickers, 32 - Killed November 17, 2011 Githe Goines, 23 - Killed December 29, 2011 Crain Conaway, 47 - Killed January 17, 2012 Deoni Jones, 23 - Killed February 2, 2012 Coko Williams, 35 - Killed April 4, 2012 Tyrell Jackson, 23 - Killed April 4, 2012 Paige Clay, 23 - Killed April 16, 2012 Brandy Martell, 37 - Killed April 29, 2012 Tracey Johnson, 40 - Killed July 5, 2012 Tiffany Gooden, 19 - Killed August 14, 2012 Dewayne “Deja” Jones, 33 - Killed August 26, 2012 Kendall Hampton, 26 - Killed August 29, 2012 Evon Young, 22 - Killed January 1, 2013 Cemia “CeCe” Dove, 23 - Killed March 27, 2013 Kelly Young, 29 - Killed April 3, 2013 Ashley Sinclair, 30 - Killed April 11, 2013 Fatima Woods, 53 - Killed May 30, 2013 Jock Maurice McKinney, 50 - Killed 12 July, 2013 Diamond Williams, 31 - Killed July 14, 2013 Domonique Newburn, 31 - Killed August 20, 2013 Islan Nettles, 21 - Killed August 20, 2013 Artegus Konyale Madden, 37 - Killed September 1, 2013 Terry Golston, 44 - Killed September 6, 2013 Eyricka Morgan, 26 - Killed September 24, 2013 Brittany Stergis, 22 - Killed December 5, 2013 Kandy Hall, 40 - Killed June 3, 2014 Yaz'min Shancez, 31 - Killed June 19, 2014 Tiffany Edwards, 28 - Killed June 26, 2014 Mia Henderson, 26 - Killed July 16, 2014 Aniya Parker, 47 - Killed October 3, 2014 Ashley Sherman, 25 - Killed October 27, 2014 Gizzy Fowler, 24 - Killed November 12, 2014 Lamar Edwards, 20 - Killed January 9, 2015 Lamia Beard, 30 - Killed January 17, 2015 Ty Underwood, 24 - Killed January 26, 2015 Yazmin Vash Payne, 33 - Killed January 31, 2015 Taja Gabrielle DeJesus, 36 - Killed February 1, 2015 Penny Proud, 21 - Killed February 10, 2015 Keyshia Blige, 33 - Killed March 7, 2015 London Chanel, 21 - Killed May 18, 2015 Ashton O’Hara, 25 - Killed July 14, 2015 India Clarke, 25 - Killed July 2, 2015 Shade Schuler, 22 - Killed July 29, 2015 Amber Monroe, 20 - Killed August 8, 2015 Kandis Capri, 35 - Killed August 11, 2015 Elisha Walker, 20 - Killed August 13, 2015 Kiesha Jenkins, 22 - Killed October 6, 2015 Zella Ziona, 21 - Killed October 15, 2015 Veronica Banks Cano, mid 30s - Killed February 19, 2016 Maya Young, 25 - Killed February 21, 2016 Demarkis Stansberry, 30 - Killed February 27, 2016 Kedarie Johnson, 16 - Killed March 2, 2016 Shante Isaac, 34 - Killed April 10, 2016 Keyonna Blakeney, 22 - Killed April 16, 2016 Tyreece Walker, 32 - Killed May 1, 2016 Mercedes Successful, 32 - Killed May 15, 2016 Goddess Diamond, 20 - Killed June 5, 2016 Deeniquia Dodds, 22 - Killed July 13, 2016 Dee Whigam, 25 - Killed July 23, 2016 Skye Mockabee, 26 - Killed July 30, 2016 Rae'Lynn Thomas, 28 - Killed August 10, 2016 T.T. Saffore, mid-20s, Killed September 11, 2016 Crystal Edmonds, 22 - Killed September 16, 2016 Jazz Alford, 30 - Killed September 23, 2016 Brandi Bledsoe, 32 - Killed October 12, 2016 Noony Norwood, 30 - Killed November 5, 2016 India Monroe, 29 - Killed December 21, 2016 Mesha Caldwell, 41 - Killed January 4, 2017 JoJo Striker, 23 - Killed February 8, 2017 Jaquarrius Holland, 18, - Killed February 19, 2017 Keke Collier, 24 - Killed February 21, 2017 Chyna Gibson, 31 - Killed February 25, 2017 Ciara McElveen, 21 - Killed February 27, 2017 Alphonza Watson, 38 -Killed March 22, 2017 Kenne McFadden, 27 - Killed April 9, 2017 Chay Reed, 28 - Killed April 21, 2017 Brenda Bostick, 59 - Killed April 25, 2017 Sherrell Faulkner, 46, Died May 16, 2017 Ava Le'Ray Barrin, 17 - Killed June 25, 2017 Ebony Morgan, 28 - Killed July 2, 2017 TeeTee Dangerfield, 32 - Killed July 31, 2017 Jaylow McGlory, 29 - Killed August 4, 2017 Kiwi Herring, 30 -Killed August 22, 2017 Kashmire Redd, 28 - Killed September 4, 2017 Derricka Banner, 26 - Killed September 12, 2017 Candace Towns, 30 - Killed October 31, 2017 Brooklyn BreYanna Stevenson, 31 - Killed November 27 2017 Brandi Seals, 26 - Killed December 13, 2017 Celine Walker, 36 - Killed February 4, 2018 Tonya Harvey, 35 - Killed February 6, 2018 Phylicia Mitchell, 46 - Killed February 23, 2018 Amia Tyrae, 28 - Killed March 28, 2018 Sasha Wall, 29 - Killed April 1, 2018 Nino Fortson, 36 - Killed May 13, 2018 Gigi Pierce, 28 - Killed May 21, 2018 Antash’a Devine Sherrington English, 38 - Killed June, 2018 Diamond Stephens, 39 - Killed June 18, 2018 Cathalina Christina James, 24 - Killed June 24, 2018 Keisha Wells, 50s - Killed June 24, 2018 Sasha Garden, 27 - Kille July 19, 2018 Vontashia Bell, 18 - Killed August 30, 2018 Dejanay Stanton, 24 - Killed August 30, 2018 Shantee Tucker, 30 - Killed September 5, 2018 Londonn Moore, 20 - Killed September 8, 2018 Ciara Minaj Carter, 31 - Killed October 3, 2018 Regina Denise Brown, 53 - Killed October 10, 2018 Tydi Dansbury, 37, Killed November 26, 2018 Keanna Mattel, 35 - Killed December 7, 2018 Dana Martin, 31 - Killed January 6, 2019 Jazzaline Ware, 34 - Killed March 25, 2019 Ashanti Carmon, 27, Killed March 30, 2019 Claire Legato, 21 - Killed April 15, 2019 Muhlaysia Booker, 23 - Killed May 18, 2019 Michelle “Tamika” Washington, 40 - Killed May 19, 2019 Paris Cameron, 20 - Killed May 25, 2019 Chynal Lindsey, 26 - Killed June 1, 2019 Chanel Scurlock, 23 - Killed June 5, 2019 Layleen Polanco, 27 - Killed June 7, 2019 Zoe Spears, 23 - Killed June 13, 2019 Brooklyn Lindsey, 32 - Killed June 25, 2019 Denali Berries Stuckey, 29 - Killed July 20, 2019 Kiki Fantroy, 21 - Killed July 31, 2019 Pebbles La Dime Doe, 24 - Killed August 4, 2019 Bubba Walker, 55 - Killed July 2019 Tracy Single, 22 - Killed July 30, 2019 Bee Love Slater, 23 - Killed September 1, 2019 Bailey Reeves, 17 - Killed September 2, 2019 Ja’Leyah-Jamar, 30 - Killed September 13, 2019 Itali Marlowe, 29 - Killed September 20, 2019 Brianna “BB” Hill, 30, Killed October 13, 2019 Yahira Nesby, 33 - Killed December 19, 2019 Monika Diamond, 34 - Killed March 18, 2020 Nina Pop, 28 - Killed May 3, 2020 Tony McDade, 38 - Killed May 27, 2020
All of them should still be here with us today.
Say their names.
I was scrolling down this list and the longer I realized this list was the more tears formed in my eyes.. Say their names ✊🏽✊🏾✊🏿
Support the BLM movement. Black people were the backbone of the pro-LGBTQ+ protests and riots in the 1960’s and without them, we would not have the rights that we have today. The LGBTQ+ community is an inclusive one, and it has no place for racism. We stand with our black siblings. We need to be loud and we need to be heard. #BlackLivesMatter






