Log in
Avatar

maia

@kyrosachilles

she/they | nd | bi a dark academia whore crying after her shows
Posts
kyrosachilles
glittergluekintsugi
Avatar
papasmoke

Please list your full genome sequence in your bio

Avatar
papasmoke

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

Avatar
papasmoke

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

kyrosachilles

its been like a year since i last came here wow and im still as insane as before incredible

kyrosachilles
kinkybazsmolsnow
Avatar
laurent-roi

damen: well there’s good news and bad news. the bad news is that i gave up delpha in exchange for laurent’s aid in the south. on a more positive note, the good news is that he knew who i was when we made love. 

nikandros:

damen: you’re still thinking about the bad news, aren’t you?

nikandros: there’s no good news, damen. there’s bad news and irrelevant news.

kyrosachilles
donttouchtheneednoggle
Avatar
wehaveallgotknives

unrelated to last post but topical: as the child of lawyers, I got one thing drilled into me from age 10: don’t fucken talk to cops. never talk to cops.

Avatar
queeranarchism

Don’t talk to cops about insignificant things, it’s a trick to get you into a talking-mode to gradually work to more sensitive questions.

Don’t talk to workers inside a police station (medics, cleaners, people bringing bitter cold coffee), assume they’re all cops.

If you absolutely must talk to a medic, deliver your essential medical information to them in one sentence and go back to ‘no comment’ after that. Do not get in a conversation.

Don’t accept a lawyer offered by the cops or a lawyer you don’t know. ONLY take the lawyer provided by the activist organization you’re part of and ask to see their ID. Do not believe people who claim they represent the same firm. If in doubt, keep your mouth shut. 

Avatar
rojo-ojo

I've been detained. I've been arrested. I know the instinct when you're around other human beings is to try to relate to them on a human level. I get it, being detained is scary, you're in cuffs, maybe you're in the back of a squad car, or in a van in the event of mass arrest. The first thing you're going to want to do is just... Talk to someone. Anyone. To remember that we're all human here, or to try to win them over.

Don't. Cops aren't people. They aren't your friends, and they aren't there to protect you. They're the bloodhounds of the state. Every comment is a hint, every question has ulterior motives, and they are just trying to pump your for information.

The coffee is a trick, your one call is monitored, they are not your fucking friends. You're an enemy combatant and every single interaction you have with them is a component of an interrogation. Close your mouth, ask for legal counsel, and always remember, cops aren't just allowed to lie to you, it's one of their favorite things to do.

Avatar
wehaveallgotknives

you cannot win a cop over. you cannot befriend a cop. a cop does not see you as a person, they see you as a perpetrator - you should view them the same.

Avatar
queeranarchism

Also be careful about anyone in the same arrest van / cell as you because - cops are known to put undercovers in cells to interrogate the arrested - everything is monitored all the time

Comfort and support your comrades, but do not share personal details or discuss anything that could be used against you.

Avatar
solluxisms

I highly recommend everyone read this thread and watch this video at the end. Pulling the video out for easy access/in case that link ever gets broken:

kyrosachilles
gratatata-shalala
Avatar
apelcini

I think humans are meant to see the ocean.

fun fact, there may be an explanation for this in something called the Aquatic Ape Hypothesis!  There are some evolutionary biologists who think that at some point after the split from chimpanzees, our ancestors may have briefly become aquatic mammals but bailed out before becoming fully adapted to life in the water.  There are several quirks of human anatomy that may suggest this is the case:

  1. Humans have a much higher percentage of body fat than most other land-dwelling mammals, we’re much closer to various aquatic mammals who rely on that fat for buoyancy & insulation.
  2. We may have lost most of our body hair because it would have created drag as we swam through the water, but kept most of our head hair because it would protect our scalps from damage from the sun when we would come up for air.
  3. We’re one of the only land-dwelling animals that are able to hold our breath.
  4. Human infants instinctively know to hold their breath underwater, keep their heads up, and try to swim upwards (they’re not strong enough but they do the motions correctly), whereas the infants of other primates simply panic and drown, suggesting this isn’t simply due to having spent 9 months in the uterus.  
  5. Children who swim very frequently are able to contract their pupils at will, something that is helpful in seeing more clearly underwater.  This can especially be seen among children of the Moken tribe from an island off the coast of Thailand who rely on this ability for catching fish and clams, but can be trained in children anywhere.
  6. Humans are the only primates who retain some small amount of webbing between our fingers and toes, some people more than others. 
  7. Females have permanent breasts with fatty tissue that doesn’t assist in milk production but does assist in buoyancy that would be ideal for breast feeding while floating on your back.
  8. Our dependence on iodine for proper brain and metabolic function is highly unusual for land dwelling animals but would not be an issue for ocean dwelling creatures.

Now, this is only a hypothesis, and it has opponents who argue that aquatic life isn’t the only explanation for any of these traits and there isn’t sufficient evidence in the fossil record, however the fossil record also doesn’t rule the possibility out.  So who knows, this may be the source of your longing for the ocean!

kyrosachilles
one-time-i-dreamt
Avatar
luischocolatier

COMMISSIONS OPEN!

Okay so… Adobe just did me really dirty and screwed me over in the payment. I want to get it sorted out but I’m gonna need a lot of money meanwhile so please, consider commissioning me!

Here are my rates:

A sketch starts at $5

A simple cel shaded character is $12     +$4 per extra character      +$2-$4 per extra detail      +$6 for detailed background

5 prop designs go for $8 if cel shaded     +$1 per extra prop

A minute of music (simple piano voicing) is $20     +$20 per minute if fully orchestrated

Also consider following me on my Patreon which I opened back on October 1st! You’re going to be able to see all the stuff I’m working on (execpt for secret projects) and sometimes you’ll also be able to decide what I work on next!!!

Here is the link!

Thank you so much for listening to me.

If you can’t commission me at least make sure to reblog and/or share! The more people that sees this the higher possibility I’ll get the money!

kyrosachilles
spnhunters
Avatar
beatrixkiiddo

I need your help

I promised myself i wasn’t gonna post about this again, because it hasn’t worked for the longest time, and i felt like i was just bothering people, not to tell how much it ashames me that i can’t even provide food for my own house. And also because most of the people who follow me are my friends and idk its not the proudest thing to ask for help like this.

My grandmother is over 70, she had an inflamation on the veins of her legs january, and i basically started taking care of her ever since. Hence i cannot leave to get a job or whatever. And with the pandemic i haven’t been able to look for it last year either. I live in brazil and the situation is still the worst here, i only go out for utterly necessary things and my grandmother basically just stays at home all the time.

I came asking for your help because there is basically nothing on the fridge or cabinet for us to eat and i dont even know what we’re eating for lunch today. i dont think we even will, tbh. My cats are also in trouble. They probably have 2 or 3 days worth of food, and i dont have a way to provide them with food. Also it’s not healthy for animals to eat human food.

If you can send any amount, please do. It really helps, anything helps.

My paypal email is caroline.rdf@outlook.com and you just need to choose “payment for products”. 

Even if you cant donate much, if you can donate $1, it helps. And if you can’t at all, i completely understand. All i ask is that you reblog this to let more people know about my situation and hopefully help me. It’s been really hard few months, believe me.

If anyone needs proof of anything, documents, receipts, pictures, anything, i am willing to send. Just send me a message and i’ll be glad to send you whatever proof you want. 

Thank you guys for reading this, please reblog this, and please help me. I am in very much need of help.

kyrosachilles
jazkier
Avatar
killjoyfabulous

I like tumblr because it’s the only social media platform that isn’t like “look how great my life is going right now!” it’s literally just shitposting. it’s the one website that doesn’t destroy your self esteem. no one has ever read a text post that just said “bungus” and been like “wow they have their whole life together and I wish that could be me” and I’m here for it

Avatar
kyrosachilles

i feel like ur in the wrong side of twitter for you to say this ..

kyrosachilles
evanbuckdiaz
Avatar
bellakitse

Seriously, and this is not me saying this cause Carlos Reyes is my favorite character, but this is the best episode of the season so far and the writers NEED TO STOP SLEEPING ON RAFAEL SILVA.

Put some damn respect on the guy’s name cause he’s a powerhouse.