“hi welcome to mcdonalds what can i get for you?”
“yeah can i get a deluxe quarter pounder with cheese?”
“absolutely, do you want the meal or just the sandwich?’
“uuuuuh hold on”
*fishes something out of my pocket*
“mikey what do i do?”
“get the fries. youll need the energy in the coming days”
*stuffs it back in my pocket*
“uhh yes please the meal would be great”
Now that it’s back it’s hard to remember a time where they sued to get the post taken down
kisses your face [ +1 sanity ] kisses your face [ +1 sanity ] kisses your face [ +1 sanity ] kisses your face u [ +1 sanity ] kisses your f
Stop! I like being insane! Sanity is for the weak!
then this post isn’t for you now is it
please let me out
sorry i have a boyfriend
i’m trapped in your attic
listen im not intrested
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have
It’s called Cyberpunk 2077 because when you see it you’ll turn 2077 degrees and walk away
me after seeing Cyberpunk 2077
For real though, David Harvey is the man when it comes to Marx’s Capital, he’s been reading and teaching about it for decades and I highly recommend checking him out. He’s got free classes on youtube and all, it’s great and really accessible if you don’t know much about economics or theory.
