A MAP OF DIVERSITY IN THE HUMAN MICROBIOME

Over the course of our lives, humans are colonized by a tremendous diversity of commensal microbes, which comprise the human microbiome.

The human microbiome is dominated by four phyla: Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria.

The collective genetic potential (metagenome) of the human microbiome is orders of magnitude more than the human genome, and it profoundly affects human health and disease in ways we are only beginning to understand.

Source:  Trends in Genetics,  Volume 29, Issue 1, January 2013

Biodiversity and functional genomics in the human microbiome
by Xochitl C. Morgan, Nicola Segata, Curtis Huttenhower.

HOW TO READ THE MAP

  • In the center is a phylogenetic tree of organisms abundant in the human microbiome. Commensal microbes are indicated by circles, and potential pathogens are indicated by stars.
  • The middle ring corresponds to body sites at which the various taxa are abundant and is color-coded by site [e.g., Ruminococcus (blue) is found mostly in the gut, whereas Lactobacillus (purple) is found mostly in the vagina].
  • The bar heights on the outside of the circle are proportional to taxa abundance at the body site of greatest prevalence [e.g., Streptococcus mitis (yellow) dominates the inside of the cheek, whereas the gut is abundant in a variety of Bacteroides].
  • The intensity of external colors corresponds to species prevalence in each body site.

My gut microbiome is better than yours…maybe.. who knows right now. Based on 22 faecal metagenomes from four countries scientists from the Metagenomics of the Human Intestinal Tract (MetaHIT) Consortium have identified three robust gut microbiome types. Their person specific association and effect on health and development is still not clear, but it is a really cool finding in gut metagenome research.

Highlights

We use several plasmid purification methods to allow maximum plasmid diversity

We exclude and monitor the presence of genomic DNA in our plasmid preparations

We selectively amplify plasmid DNA from an environmental sample

The method yields high quality and quantity plasmid DNA suited for deep sequencing

This method allows the study of the plasmids within a given microbial environment

Job: WestVirginiaU.MicrobialMetagenomics
Tenure-Track position in Microbial Metagenomics: As part of a University-wide expansion in genomics-oriented research, West Virginia University invites applications for a tenure-track position at the Assistant Professor level in the Department of Biology (http://bit.ly/XS3yHm), to begin August 2015. The successful candidate will join a rapidly-growing genomics community at WVU spanning plant, microbial, and animal systems. We seek an individual who will use the power of molecular and/or systems-enabled approaches to answer basic and applied questions related to microbial ecology and evolution, including, for example, questions concerning biotic interactions within the context of plant or animal microbiotas. Applicants should have a broad biology background and strong interdisciplinary skills to develop an externally-funded independent research program and contribute to the undergraduate and graduate teaching missions of the department. Requirements include a PhD or equivalent degree in biology or a related field, a strong record of scholarly publications, strong post-doctoral experience, excellent written and oral communication skills, and the potential to secure external funding. Qualified applicants should submit a single PDF file including: 1) cover letter; 2) research statement; 3) teaching philosophy; 4) curriculum vitae; 5) up to three representative publications; and 6) contact information for 3 references to WVUBiology@mail.wvu.edu. Please specify $B!H(BMicrobial Metagenomics position$B!I(B in the email subject. Review of applications will commence on November 15, 2014. For more information about the position contact Rita Rio (rita.rio@mail.wvu.edu). For more information about WVU and the city of Morgantown, WV: http://bit.ly/XS3yXE. WVU is an EEO/Affirmative Action Employer and the recipient of an NSF ADVANCE award for gender equity. The university welcomes applications from all qualified individuals, including minorities, females, individuals with disabilities, and veterans. Stephen DiFazio Associate Professor, Department of Biology Director, WVU Genomics Core Facility 5200 Life Sciences Building West Virginia University 53 Campus Drive Morgantown, WV 26506-6057 (304) 293-5314 Fax: (304) 293-6363 spdifazio@mail.wvu.edu http://bit.ly/1ev8MtL http://bit.ly/1x51RWu Stephen DiFazio

via Gmail
16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles

Sample storage conditions, extraction methods, PCR primers, and parameters are major factors that affect metagenomics analysis based on microbial 16S rRNA gene sequencing. Most published studies were limited to the comparison of only one or two types of these factors. Systematic multi-factor…
Source:16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles

Graduate position: TuftsU.FoodMicrobialEcolEvolution

PhD Positions in the Wolfe lab @ Tufts University, Medford, MA (Boston Area), USA Ecology and evolution of microbes in food systems The Wolfe lab in the Department of Biology at Tufts University is seeking several Ph.D. students to join the lab in the Fall of 2015. Our lab studies the ecology and evolution of microbial communities, using tractable microbial communities isolated from food (cheese, salami, and other fermented foods) as model systems. Our work spans taxonomic boundaries (we study both prokaryotes and eukaryotes) and integrates a wide variety of techniques including experimental evolution, metagenomics, comparative genomics/transcriptomics, genome engineering, and in situ community reconstructions. Our research questions are strongly anchored in basic biology, but our work will help address emerging issues in human health and food security. Current research in the lab is aimed at linking ecological and evolutionary patterns in microbial communities with the molecular mechanisms that generate these patterns. What are the molecular mechanisms that govern species distributions or community-level traits? How do these mechanisms evolve within a community and what are the consequences of trait evolution within microbial communities? We are particularly interested in exploring these questions with a focus on bacterial-fungal interactions. The Wolfe lab is based in a brand new open lab space associated with the Tufts University Medford Campus. In addition to diverse research being conducted in the Department of Biology that spans the entire breadth of biology (http://bit.ly/1600Zpa), the Sackler School of Graduate Biomedical Sciences at the Tufts Medical School has an outstanding group of microbiologists (http://bit.ly/WDvgqA). There are also numerous potential collaborators and resources at the Tufts Friedman School of Nutrition and the Cummings School of Vet Medicine. A new university-wide initiative, the Tufts Institute for Innovation, is providing resources to support interdisciplinary research projects that explore how microbes can improve the environment and the human condition (http://bit.ly/1niy6Ix). The academic community in the Greater Boston Area has an unprecedented collective wealth of resources in microbiology, ecology, and evolution. Applicants should have a background in ecology, evolution, molecular biology, mycology, and/or microbiology. Ideal candidates would also have a strong interest in the biology of food systems. Our work has incredible potential for science outreach and education, and members of my lab will be encouraged to communicate their science through social media, writing, and public outreach events. Students will be provided ample training for postgraduate work in academia, but I will strongly support professional development to help graduate students become leaders in industry, agriculture, and other non-academic career paths. A formal lab website is in production. In the meantime, candidates should check out my personal website (http://bit.ly/1xWMGQz) for an overview of my past and current research and teaching activities. Interested candidates should contact Benjamin Wolfe via email (benjamin.wolfe@tufts.edu) to explain their past research experience/interests and why they might be a good fit for the lab. Information on the Tufts Department of Biology Graduate Program, including graduate admissions deadlines, can be found here: http://bit.ly/1xWMH6M bewolfe@gmail.com

via Gmail

16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles

Primers, PCR amplification, and 454 pyrosequencing The V1–V3 region of the 16S rRNA gene was used in most 16S rDNA sequencing-based metagenomics studies and was also chosen in this study. Instead of using 16S primers 27F1 (AGAGTTTGATCCTGGCTCAG) and 534R…
Source: 16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles

Postdoc: GeorgeWashingtonU.Metagenomics
Postdoctoral Fellow in Metagenomics at George Washington University We are seeking a highly motivated postdoctoral researcher to design and carry out analysis of high-throughput sequencing microbiome data as part of a series of studies on the role of infectious agents on mental disorders with a focus on schizophrenia. Additionally, the researcher will also be involved in the development of the PathoScope pipeline for taxonomic profiling of metagenomic samples. The project is part of an ongoing collaboration between the Stanley Neurovirology Laboratory, Johns Hopkins School of Medicine and the Computational Biology Institute, George Washington University. The overall goal of this research is to contribute to our program devoted to the elucidation of the role of infection and immunity in the etiology of schizophrenia and bipolar disorders. Interests also include elucidating the role of perinatal infections in subsequent brain development. Applicants must possess a PhD in a relevant discipline (Computational Biology, Bioinformatics, Microbiology, Microbial Ecology), with experience in metagenome data analysis and an understanding of the key issues and relevant tools in the field. An understanding of statistics is essential. Experience with DNA and RNA extraction and sequencing is useful but not essential. A strong quantitative background and good programming skills (R, Python/Perl) are all required. The initial contract will be for one year, renewable based on performance. Salary is competitive with benefits. The selected candidate will be based on GWs Computational Biology Institute. For further information about the Computational Biology Institute at George Washington University, please see http://cbi.gwu.edu. For questions relating to this opportunity, please contact Keith Crandall, Director, Computational Biology Institute, The George Washington University, kcrandall@gwu.edu. Interested candidates can apply for this position at www.gwu.jobs where they can search on the following Posting Number: Staff - 003768. The anticipated start date is flexible, but the position can start as early as October 1, 2014. Review of candidates is ongoing and will continue until the position is filled. The George Washington University is an Equal Opportunity/Affirmative Action Employer and seeks to attract an active, culturally and academically diverse faculty of the highest caliber. Keith Crandall

via Gmail
Postdoc: CEA_France.MarineGenomics
Post-doc position in marine genomics / metagenomics / metatranscriptomics TARA Oceans project TARA Oceans is a multidisciplinary project with 24 teams over 10 countries ( http://bit.ly/YgunG7), covering oceanography, bioinformatics, chemistry, microbiology, physics& genomics, aiming to collect and analyze marine planktonic organisms up to 2 mm (viruses, prokaryotes, protists and metazoans). These marine organisms are key actors on several large biogeochemical cycles (nitrogen, carbon or oxygen among others) as well as on marine food chain. During a three years journey across the globe, 210 sampling stations covering the main oceanographic regions were conducted (Karsenti E. PLoS Biol. 2011). A key step in this project consists in describing the planktonic community through genomic material recovered from sampled organisms in order to characterize its diversity and to understand environmental factors shaping the population. A large sequencing effort is undergone at CEA/Genoscope to determine both genomic (gene content of the different populations) and transcriptomic (the active part of the genes catalog) signatures in all gathered samples. From this data, gene catalogs are built and used to describe both taxonomic distribution and functional diversity of the populations, and to detect fluctuations between samples. In the context, we are looking for a highly motivated and talented candidate. This candidate will have to demonstrate perfect skill in: . functional analysis of eukaryotes metagenomic and metatranscriptomic data. . statistical analysis of large scale, complex and heterogeneous data. . communication with collaborating labs for integration of data. The candidate would have to handle an existing dataset to elucidate functional response of planktonic population to perturbations in the environment. This line of work will be subsequently applied to other sample sets with related scientific questions. Solid knowledge in the following areas will be a plus: . high throughput data manipulation under a Unix/Linux environment . programming skills for data treatment (shell / perl / python) . statistical analysis of genomic data (R knowledge is a plus) . biological interpretation of functional data. This position is immediately available in the Patrick Winckers group, and is located close to Paris at CEA V Genoscope (www.cea.fr, www.genoscope.cns.fr). Contact person : Eric Pelletier (eric.pelletier@genoscope.cns.fr) Jaillon Olivier

via Gmail
Text
Photo
Quote
Link
Chat
Audio
Video